21/Aug/2007
cDNA libraries of the brown planthopper, Nilaparvata lugens
Library name	Strain/Race	Organ/Tissue	Developmental stage	Sex	Vector	Cloning sites	Sequence direction
NLAA	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	abdomen	adult, 0-1 day	female	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLAB	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	abdomen	adult, 0-1 day	female	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLAC	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	abdomen	adult, 0-1 day	male	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLAD	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	abdomen	adult, 0-1 day	male	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLEA	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	egg	0-1.5 day	male + female	pGEM-T	TA cloning	sequenced from 5' end using NUP primer AAGCAGTGGTAACAACGCAGAGT
NLEB	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	egg	3-5 day	male + female	pGEM-T	TA cloning	sequenced from 5' end using NUP primer AAGCAGTGGTAACAACGCAGAGT
NLHA	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	head	adult, 0-1 day	female	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLHT	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	head + thorax	adult, 0-1 day	male	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLMA	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	midgut	adult, 0-5 day	female	pGEM-T	TA cloning	sequenced from 5' end using NUP primer AAGCAGTGGTAACAACGCAGAGT
NLMB	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	midgut	adult, 0-5 day	male	pGEM-T	TA cloning	sequenced from 5' end using NUP primer AAGCAGTGGTAACAACGCAGAGT
NLNA	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	whole body	nymph, 1st instar	male + female	pGEM-T	TA cloning	sequenced from 5' end using NUP primer AAGCAGTGGTAACAACGCAGAGT
NLNB	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	whole body	nymph, 4th instar	male + female	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLOA	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	ovary	adult, 0-1 day	female	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLOB	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	ovary	adult, 4-5 day	female	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLOC	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	ovary	adult, 4-5 day	female	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLSG	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	salivary glands	adult, 0-5 day	female	pGEM-T	TA cloning	sequenced from 5' end using NUP primer AAGCAGTGGTAACAACGCAGAGT
NLTA	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	testis	adult, 0-1 day	male	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC
NLTH	Izumo strain collected at Izumo, Shimane 1987 reared on rice seedlings	thorax	adult, 0-1 day	female	pBluescript SK-	EcoR1 for 5' Xho1for 3'	sequenced from 5' end using SK primer CGCTCTAGAACTAGTGGATC